Protein Synthesis Making Proteins 2009-2010

Protein Synthesis Making Proteins 2009-2010

Cell organization DNA DNA is in the nucleus genes instructions for making proteins want to keep it there protected in the nucleus “locked in the vault” cytoplasm nucleus

Cell organization Proteins chains of amino acids made by a “protein factory” or ribosome in cytoplasm Rough ER protein for export, free ribosome Protein for cell protein factory ribosome cytoplasm build proteins nucleus ribosome

Passing on DNA information Need to get DNA gene information from nucleus to cytoplasm need a copy of DNA messenger RNA (mRNA) is made from DNA mRNA can leave the nucleus cytoplasm build proteins mRNA nucleus ribosome

RNA Translation: Protein Synthesis http://www.biologyjunction.com/ ANIMPROT.htm

From nucleus to cytoplasm transcription DNA Ribosome mRNA protein translation trait nucleus cytoplasm

DNA vs. RNA DNA deoxyribose sugar nitrogen bases G, C, A, T T:A C:G double stranded RNA ribose sugar nitrogen bases G, C, A, U U:A C:G single stranded

Transcription Making mRNA from DNA DNA strand is the template (pattern) pairing bases U:A G:C Enzyme RNA polymerase

Pairing bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T

Pairing bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T

Pairing bases of DNA & RNA Pair RNA bases to DNA bases on one of the DNA strands A G U A G G U U C A AG C C G A U A C A C C RNA polymerase A U G T G G T A C A G C T A G T C A T CG T A C CG T U C

Pairing bases of DNA & RNA U instead of T is matched to A DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC ribosome A C C A U G U C G A U C A G U A G C A U G G C A

cytoplasm protein nucleus ribosome A C C A U G U C G A U C A G U A G C A U G G C A trait

How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA mRNA A C C A U G U C G A U C A GU A GC A U G GC A aa aa aa aa aa aa aa aa

How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG mRNA ribosome AUGCGUGUAAAUGCAUGCGCC ? protein aa Met Arg Val Asn Ala Cys Ala aa aa aa aa aa aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? aa

mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA ribosome AUGCGUGUAAAUGCAUGCGCC ? Met Arg protein Cys Ala Val Asn Ala Codon block of 3 mRNA bases

The mRNA code For ALL life! strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC codon tRNA amino acid UAC GCA Met Arg CAU Val anti-codon Anti-codon block of 3 tRNA bases

mRNA to protein Translation The working instructions mRNA The reader ribosome The transporter transfer RNA (tRNA) ribosome mRNA A C C A U G U C G A U C A GU A GC A U G GC A U GG aa aa tRNA U A C A G tRNA tRNA aa aa aa C U AG tRNA aa

From gene to RNA to protein aa aa aa aa aa aa aa ribosome A C CA U GU C G A U C A GU A GC A U GGC A aa trait

From gene to RNA to protein aa cytoplasm aa transcription DNA translation aa protein mRNA aa aa aa aa ribosome A C CA U GU C G A U C A GU A GC A U GGC A nucleus tRNA aa trait

cytoplasm transcription protein translation nucleus trait

From gene to protein protein transcription translation